Decription

PrimerScore is a robust high-throughput primer design tool that designs multiple types of primers in one click, including face-to-face, back-to-back, and nested primers, as well as evenly full-covered primers on target regions. PrimerScore precisely evaluates candidate oligos′ features, containing specificity, SNPs, dimers, and other basic features. Then it scores the oligos and pairs according to the features using growth curve piecewise function and weighted sum model. Finally, it provides the highest-scoring primer pairs or probes and examines for cross-products and cross-dimers among the outputted primers.

Applications

PrimerScore can design various types of primers, as shown in Figure 1.

alternate text

Figure 1. The types of primers that can be designed using PrimerScore and their applications. The primers are denoted using blue arrows, probes using blue horizontal bars, and the target single nucleotide polymorphisms (SNPs) using red vertical bars.

Types of primers:

  • Face-to-face primers

    Contain a forward primer and a reverse primer having an inward direction. The forward primer is complementary to a DNA template chain at one end of the target region, and the reverse primer is complementary to another DNA template chain at the other end of the target region.

  • Back-to-back primers

    Contain a forward primer and a reverse primer having an outward direction. Used for cyclized DNA templates. The forward primer is complementary to a DNA template chain, and the reverse primer is complementary to another DNA template chain.

  • Nested primers

    Contain two forward primers, which are used for two PCR reactions. The product of the first PCR reaction is used as the template for the second PCR, whose primer is placed internal to the first PCR primer.

PrimerScore can meet a variety of application requirements. Some of these are mentioned below:

  • Quantitative polymerase chain reaction (qPCR)

    The input file is a target sequence file or a target region file, “Primer Type” is “face-to-face,” “Cover Type” is “Single,” and the TaqMan probe is selectable.

  • Arms

    The input file is a target spot file, “Primer Type” is “face-to-face,” “Distance To SNP” is “0,0,0,0,” “Cover Type” is “Single,” and the TaqMan probe is selectable.

  • Single nucleotide polymorphism (SNP) genotyping

    The input file is a target spot file, “Cover Type” is “Single,” and “Primer Type” and “Distance To SNP” are set as per requirements.

  • Full-covered

    The input file is a target sequence file or a target region file, “Cover Type” is “Full-covered,” and “Interval between primers,” “Primer Type,” and “Primers Distance” are set as per requirements.

Inputs

The input content can be imported by copying and pasting it in a text box or uploading a file. The database for checking specificity is limited to Human_GRCh37 and Human_GRCh38 at the moment, more databases will be supported in the future, and this can be set with the “Database” option.

PS. The downloaded command-line supports any species and database for checking specificity.

The input content to design oligos supports three types:

  • Template sequences

    These must be in the FASTA format, consisting of header lines beginning with “>” and sequence lines.

  • Target regions

    These must be in the BED format, consisting of three or four columns:

    1. Chromosome Name

    2. Chromosome Start

    3. Chromosome End

    4. Identity (ID)(optional)

      ID of regions, used for the primer′s name; it is usually the name of a gene or an exon and can be a user-defined name.

    Template sequences will be extracted according to the input regions.

  • Target spots

    Consist of five columns:

    1. Chromosome Name

    2. Chromosome Position

    3. ID

      ID of target spot, used as a prefix of the primer name; it is usually an annotated variant in dbSNP and can be a user-defined name.

    4. Reference base(s)

      The base of the reference at this position.

    5. Alternate base(s)

      The variants found in dataset that differ from the reference.

    Note:

    1. Primers are designed upstream and downstream of the target spots.“Distance to SNP” denotes the distance between 3′ end of the primer and the target spot.
    2. “Cover Type” must be “Single,” and each spot will return three (“# of pairs to return”) primer pairs with the highest scores.

The input content to evaluate pre-designed oligos only supports one type:

  • Primer lists

    Must be two columns:

    1. Oligos ID

      Primer ID must be xxx-F, xxx-R, xxx-1, and xxx-2, and probe ID must be xxx-P; here, xxx is the name of the primer and probe.

    2. Oligos Sequence

    For instance:

PPBP-B1-F     TTCTGGAAACAACTCTAGCTCAGC
PPBP-B1-P     AGCCTCAGACTTGATACCACCCCTTCCTGTAA
PPBP-B1-R     TGTTACAGGAAGGGGTGGTATCA
PPBP-B6-1     TCACTCAGAGGTCTTCTGGTTCT
PPBP-B6-P     ACAACTCTAGCTCAGCCTTCTCCACCATGAG
PPBP-B6-2     TGGTATCAAGTCTGAGGCTCATG

Outputs

PrimerScore returns a website to the results, containing a brief result on the website (Fig.2) and several links to detailed output files (Fig.3): primers (maybe containing probes) file, design status file and log file, cross products file and cross dimers file when designing multiplex primers. Sample out

_images/website-result.png

Figure 2. An example of result returned on the website.

_images/file-links.png

Figure 3. An example of several links to detailed output files.

  • Primers file

    The file is named as “.final.result” and contains 23 or 24 columns(Tab.1).

Table 1. Primer file format
Field Description
Chr Chromosome name
Start Chromosome position of primer 5ʹ end
Strand Chromosome strand
ID Primer ID, xxx-1 and xxx-2 is a primer pair, in which xxx-1 is primer1 and xxx-2 is primer2.
Seq Primer sequence
Len Primer length
ProductSize Product size (does not exist when pairs are not face-to-face)
Dis2Target Distance between the 3′ end of primer1and the target spot (only exists when the target file is a target spot file)
ScoreTotal Total score of primer pair, summation of ScorePair, ScoreOligo of primer1 and ScoreOligo of primer2.
ScorePair Scores of each pair feature. ScorePair of primers respectively are scores of the 3′ end of primer1 to the target spot (Probe 5′end), distance between pair, length difference between pair, tm difference between pair, and specificity of the primer pair. Full scores of each feature respectively are 20, 30, 10, 10, and 30, which add up to100. ScorePair of primer1 and primer2 in the same pair is the same. ScorePair of probe is the score of probe specificity.
ScoreOligo Oligo score | scores of each oligo feature. Scores of the primers′ Tm, GC, hairpin, end3 A num, end3 stability, snp, poly, and specificity. Weights are respectively 1.5, 2, 1.5, 0.5, 1, 1.5, 1.5 and 0.5. Scores of the probes′ Tm, GC, hairpin, CG content diff, 5′end is G, snp, poly, and specificity. Weights are respectively 2, 1.5, 1, 1, 1, 1.5, 0.5 and 1.5. The full score of oligo is 100, the full score of each feature is 10, and weighted sum of each feature score is the final oligo score.
Tm Primer melt template
GC GC content
Hairpin Hairpin tm calculated by primer3-ntthal
DimerType Dimer type. AmpEndMeet: The 3ʹ end of the primer meets itself with no mismatch. AmpEndMap: The 3ʹ end of the primer maps itself with several mismatches, and the 3ʹ end bases are both mapped exactly.
DimerSize Dimer product size.
EndANum Primer 3′end A number.
EndStability Primer 3′end stability.
SNP SNPs covered by primer sequence: Position, Type(S:SNP, D:Deletion, I: insertion), Length(S:1, D/I:≧1), and primer sequence-added SNP as shown in table 1.
Poly Tandem repeats of primer sequence: Position, Repeat Base (A|T|C|G), Repeat Length.
OligoBound Oligo bounds number| the highest three bound Tm.
BoundNum The number of primer pair binding to database sequences, i.e the number of primer pair′ products. If it is more than 1, the primer pair is not specific.
HighestEff The highest three efficiencies.
HighestInfo Detailed bound information of the highest three efficiencies, separated by a semicolon. The information successively is primer distance, “/,” chromosome name, primer1 strand, the 3ʹ end position of primer1, primer1 bound visualization(as showed in Fig.4), primer1 bound TM, primer2 strand, the 3ʹ end position of primer2, primer2 bound visualization (as showed in Fig.4), primer2 bound TM.
alternate text

Figure 4. An example of bound visualization information. The first line represents the primer sequence, the second line shows bound visualization, and the last line represents the nonspecific amplified template sequence. “|” denotes match, “*” denotes mismatch, “^” denotes deletion, “-“ denotes insertion, and “#” denotes end sequence not mapped.

Table 2. Polymorphism change to a new base.
Ref Alt New
G A R(degenerate)
G A,T D(degenerate)
AAAG A AEEE
G GA I
G GAA J
G GAAA L
G GATTTT L
G GA,GAAA L

  • Cross-product file when designing MultiPlex primers

    The file is named as “.final.cross.product” and consists of header and content lines. Header lines start with “>,” followed by two primer IDs and product numbers. Each content line contains the primer′s efficiency and detailed binding region information, including primer distance, “/,” chromosome name, primer1 ID, primer1 strand, the 3ʹ end position of primer1, primer1 bound visualization (as shown in figure2), primer1 bound TM, primer2 ID, primer2 strand, the 3ʹ end position of primer2, primer2 bound visualization (as shown in figure2),and primer2 bound TM.

  • Cross-dimer file when designing MultiPlex primers

    The file is named as “.final.cross.dimer” and contains five columns(Tab.3).

Table 3. Cross dimer format
Field Description
ID1 Primer ID1
ID2 Primer ID2
Type Dimer type(Fig.5). AmpEndMeet: The 3ʹ end of the primer meets itself with no mismatch. AmpEndMap: The 3ʹ end of the primer maps itself with several misma:tches, and the 3ʹ end bases are both mapped exactly. AmpOmega: Only one 3ʹ end of the primer maps with the other primer sequence with the extension length and bound tm qualified.
Size Dimer product size.
Efficiency Dimer product efficiency.
_images/dimer-type.png

Figure 5. Examples of different dimer type. The two head lines are a primer sequence, the two tail lines are a primer sequence, both containing adapter sequences. The second and third lines are sequence matched with each other, and the first and fourth lines are sequence not matched.

Notes

  • PrimerScore supports “Common Primer Type” to simplify the operation; selecting a common type will automatically set parameters, but you can of course set your own parameters. If “Common Primer Type” chooses “Generic Primer” or “Generic Primer + Probe,” the input content must be template sequences or regions, and if “Common Primer Type” chooses others, the input content must be target spots.
  • PrimerScore can design full-covered primers, designated by parameter “Cover Type.” If “Cover Type” is set to “Full-covered,” the input content must be template sequences or regions, and each template will generate many primer pairs evenly distributed across the whole template. If “Cover Type” is set to “Single,” each target will return three (“# of pairs to return”) primer pairs with the highest scores.
  • PrimerScore analyzes a number of candidate oligos, which consumes time and computational resources. Therefore, the web server only supports ≤50 target spots or regions, and each template length should be shorter than 3 times the product size of primers; for example, if product size is 200, the template length should be shorter than 600.
  • PrimerScore filters unqualified candidate oligos by default. If a target designs primers unsuccessfully (check in file “.design.status”), you can again design primers for the target by ticking “NoFilter.”

Running time

PrimerScore evaluates abundant candidate primers and performs precise specificity analysis, it usually takes about 5-20 minutes for each template or spots to design primers and probes.

Browser compatibility

_images/browser.png